http://blog.gmane.org/gmane.comp.lang.perl.bio.general hourly 1 1901-01-01T00:00+00:00 http://gmane.org/img/gmane-25t.png http://gmane.org http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17984 Hey everyone, In trying to figure out why the SeqIO::largefasta tests were being verbose about tempfile cleanup, I discovered that the PrimarySeq constructor turns on verbose, which gets inherited by LargePrimarySeq, which in turn cause RootIO to overshare about the temp files. (see PrimarySeq.pm line 164). The verbose flag was put in when Mira Han added -nowarnonempty. Turning verbose off doesn't seem to cause any tests to fail, so it looks like it might have been turned on for initial debugging purposes and never removed. Mira (or anyone else in the know), could you comment on this? Dave Dave Messina 2008-11-28T12:11:13 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17982 Chris and others interested- Under bug #2689 I've taken a stab add moving in and out of sequence coordinate systems in a general way (aa to/from nt, but also say repeats to/from mnemonics), under the guise of a subseq() method for LocatableSeq. Prob not for this release, but may be helpful for other components as things become (even) more generalized in future. This subseq also handles frameshifts. Would be grateful for comments (after the rush)- cheers MAJ Mark A. Jensen 2008-11-28T02:20:30 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17975 Hi, It shows in the tutorial, that I can use the following command to write a gene into a file. $seq_object = get_sequence('swiss',"ROA1_HUMAN"); write_sequence(">roa1.fasta",'fasta',$seq_object); I'm wondering how to write a gene (id is available) of Bio::DB:Fasta into a file. Thanks, Peng Peng Yu 2008-11-27T03:03:54 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17971 Lincoln, Scott, (and anyone else interested), One of the items on the list for the next bioperl release is whether to split off Bio::Graphics before 1.6 roles out: http://www.bioperl.org/wiki/ Talk:Release_1.6#Bio::Graphics_and_Splitting_BioPerl My general reasoning is that the Gbrowse devs can start releasing to CPAN on their own (bio-graphics specific) schedule and not be tied to the core release schedule. bio-graphics would just be tied in to a minimally compatible CPAN bioperl-core release. The link above elaborates more on the idea as well as potential issues (versioning, etc). We don't have to do it for this release, but my concern is if it doesn't happen prior to 1.6 it will have to wait until 1.7 (date unknown), thus further impeding a Gbrowse 2.0. Therefore I think it's worth delaying 1.6 a couple weeks to see how this goes. Any comments over the next week or two would be appreciated (gotta factor in the holiday break!). chris (I've set the reply-to for the bioperl l Chris Fields 2008-11-26T17:29:58 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17959 Hmm... It's been 1 hour, 23 minutes and counting since I sent my last post and I haven't received my copy yet, nor is it in the MailMan archive. What is the typical MailMan lag for this server nowadays? j IRC rules! Email drools! -grin- http://www.bioperl.org/wiki/Irc Jay Hannah 2008-11-26T14:28:47 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17958 I am trying to install bioperl 1.4 both from CPAN and from local directory after downloading but i am unable to get it running. here is some log of installation work. Please give me some suggestions how to proceed perl Makefile.PL Generated sub tests. go make show_tests to see available subtests *** Script Install Section **** Bioperl comes with a number of useful scripts which you may wish to install. Install [a]ll Bioperl scripts, [n]one, or choose groups [i]nteractively? [a] cannot unlink file for scripts_temp/bp_pg_bulk_load_gff.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_pg_bulk_load_gff.pl: P ermission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_process_gadfly.pl: Permission denied at M akefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_process_gadfly.pl: Per mission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_composite_LD.pl: Permission denied at Mak efile.PL Imtiaz M. 2008-11-26T13:52:39 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17957 Hi, I'm just curious to know if bioperl is considered complete or are there still projects that programmers can become involved in. I notice that for other bio-languages there are on-going hackathons were programmers can meet and work on a problem. Do these exist in bio-perl or is the code base now mature? thanks, tim Tim 2008-11-26T11:30:18 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17954 hey ppl ... I'm having a problem at the last step of blast installation on windows.:-( blastall -p blastn -d swissprot -i fasta_query.txt -o output.txt Its showing an Error like this: [NULL_Caption] WARNING: Unable to open swissprot.nin [NULL_Caption] WARNING: gi 157836126 pdb 2QOX Z: Unable to open swissprot.nin Any help will be appreciated !! Thanks in advance. bioperl_inquisitive 2008-11-24T17:54:28 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17953 Hello everyone, I hope I didn't duplicate anyone's work, but I couldn't find anything on this in the archives and so I patched bioperl-ext-1.5.1 to work with - bioperl-1.5.2_102 - staden io_lib 1.11.4 and not crash perl. Please see attached patch, I hope someone reading here can integrate it with the repository. There is one necessary externally visible change: instead of specifiyng /foo/include/io_lib for the headers of the staden package, one now needs to specify /foo/include, because read.h includes other files with io_lib prefix. I hope I removed the double-free bug in the right place, if the free'ing of a pointer passed into the function pgreen was intentional, another strategy will be needed. Also I found make clean to be dysfunctional, but I don't know enough about MakeMaker to fix that, thus for recompiles I used a script for cleanup (also attached). Greetings, Thomas Jahns Thomas Jahns 2008-11-20T13:04:51 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17945 Hi, I am getting two nucleotide sequences from a database and I want to quickly align and view the result online(I'll wrap it in HTML). The examples I saw online require saving files (either output file or input file). I tried StandAloneBlast and tried to pass the sequences as Bio::Seq elements as shown below First I tried the Bioperl tutorial, section "IV.2.2 Aligning 2 sequences with Blast using bl2seq and AlignIO" $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out'); my $seq1='AGCTACGATCAGCACTACGACTACGACTACGACTACACTAGCTAC' ; my $seq2='AGCTACGATCACCACTACGACTACGGCTACGACTACACGAGCTAC' ; $bl2seq_report = $factory->bl2seq($seq1, $seq2); The result I got was the following error: ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: AGCTACGATCAGCACTACGACTACGACTACGACTACACTAGCTAC not Seq Object or file name! Then I used Bio::Seq objects as shown: my $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => '/tmp/bl2seq.out'); my $seq1 = Bio::Seq->new(-id=>$seqn Alper Yilmaz 2008-11-25T18:15:56 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17944 I'm not a user of this file, so if any users of the bioperl.lisp file in svn can comment on the following two bugs it would be of tremendous help. I'm sure they're fine but I would like to know if they should be accepted for the next release. http://bugzilla.open-bio.org/show_bug.cgi?id=2641 http://bugzilla.open-bio.org/show_bug.cgi?id=2642 chris Chris Fields 2008-11-25T17:51:49 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17942 I am getting tests failing on svn trunk (bioperl-live) that appear related to Bio::Assembly changes. Florent, can you take a look at these? chris 1..4 ok 1 - use Bio::Assembly::IO; ok 2 - Testing to see if the first contig is a Contig isa Bio::Assembly::Contig not ok 3 - Testing to see if the first singlet is a Singlet isa Bio::Assembly::Singlet not ok 4 - Testing to see if the Singlet ISA Contig isa Bio::Assembly::Contig # Failed test 'Testing to see if the first singlet is a Singlet isa Bio::Assembly::Singlet' # at t/singlet.t line 25. # Testing to see if the first singlet is a Singlet isn't defined # Failed test 'Testing to see if the Singlet ISA Contig isa Bio::Assembly::Contig' # at t/singlet.t line 27. # Testing to see if the Singlet ISA Contig isn't defined # Looks like you failed 2 tests of 4. Dubious, test returned 2 (wstat 512, 0x200) Failed 2/4 subtests Test Summary Report ------------------- t/singlet.t (Wstat: 512 Tests: 4 Failed: 2) Failed tests: 3-4 Chris Fields 2008-11-25T17:31:27 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17933 Currently, we have Bio::LocatableSeq use the default (Bio::PrimarySeq) implementation of subseq(). However the returned data apparently clashes with the actual PrimarySeq documentation: Function: returns the subseq from start to end, where the first base is 1 and the number is inclusive, ie 1-2 are the first two bases of the sequence So, should the following actually return the indicated range of bases (no gaps)? Or should we clarify the above documentation to indicate subseq() returns the first x positions/columns (anything) instead of 'bases' (no gaps)? my $seq = Bio::LocatableSeq->new( -seq => '--atg---gta--', -strand => 1, -start => 1, -end => 6, -alphabet => 'dna' ); # comments indicate current returned val $seq->subseq(1,3); # returns '--a' $seq->subseq(3,6); # returns 'atg-' $seq->subseq(1,10); # returns '--atg---gt' chris Chris Fields 2008-11-24T00:31:17 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17930 Hello, any objection if I take on this and add text on http://www.bioperl.org/wiki/Ontology about ontologies? Spiros Spiros Denaxas 2008-11-23T15:39:14 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17927 Hi all, I am still a newbie to bioperl, and while searching for a way to calculate the entropy score of an alignment I came to Matrix scoring - http://doc.bioperl.org/releases/bioperl-1.4/Bio/Matrix/Scoring.html - but couldn't figure out how it relate to the Bio::Align class and objects. Can someone more knowledgeable give me a clue on how to start? Best regards, Cláudio "Patola" Cláudio Sampaio 2008-11-23T05:19:24 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17924 I dug back into the Species.pm memory leak and my less-than-ideal fix for it. First, in my defense, my previous fix only causes failures in t/Species.t if network tests are enabled. It passes the generic ones. I *thought* I'd run the tests before I committed :). The basic cause of the problem is that when species() calls Bio::Tree::Tree->new(-node=> $species_taxon), $species_taxon is a copy of $self. The tree ends up adding that node onto the classification list and it gets linked it into the descendent links, which results in a cycle. If that lousy english description left you scratching your head, here's a hacked-to-pieces version of R Voss's original test case. You'll need Devel::Cycle (YAY LINCOLN!) to run it. Find yourself a genbank file (I used gbpri21.seq, from the original bug report), put it into a directory somewhere and do something like bug.pl GBDIR /tmp (yeah, why do a while loop w/ an exit in the middle? Cut-n-paste. Why else...?) ################################################# George Hartzell 2008-11-23T00:21:19 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17923 All, Apologies in advance for the very long post. This will be placed and organized on the wiki (links below) for those who don't want to wade through the entire email. I'm putting together the general priority list for the BioPerl 1.6 release. Following are a number of items or proposals I think need to be addressed. This list is neither meant to be comprehensive nor does it represent everything that must be completed for the next immediate release, but indicates issues I believe need to be addressed prior to the release. The end game is to start setting and prioritizing goals for 1.6 and future releases. I'm sure that I've missed or glossed over a few things (and possibly missed the mark completely on others), so feel free to speak up! All comments are welcome. If there are any additional concerns or items now is the time to mention them so they can be addressed. Comments can be made here or be added to the wiki release schedule discussion page (relevant comments on the Chris Fields 2008-11-21T19:12:59 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17920 Gurus- I ran into a interesting 'bug' while taking slices of a Bio::SimpleAlign. I had set the primary_id of the original LocatableSeqs while constructing the aln. When the slice is delivered using Bio::SimpleAlign::slice(), the primary_id's didn't travel with the subseqs constructed for the subalignment, and this hammered subsequent manipulations with the subalignment. Inspecting slice(), I saw that the new objects created for the subseqs get the id (display_id) from the old, but that other properties with valid accessors in the base class are not passed along, which seemed a bit arbitrary. Course, I can set the other properties after the slice is delivered, but that seems kludgy, and the bug was strange and led to 'time spent in deeper understanding of BioPerl'. What is the philosophy: Could/should all fields/properties from the base classes be generally inherited when constructing an new derived object from an old one? cheers, Mark Mark A. Jensen 2008-11-19T03:05:34 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17910 All, I have added some general ideas on the 1.6 release here: http://www.bioperl.org/wiki/Release_Schedule It's still incomplete (I need to add a bug priority list, including the latest one Sendu just posted); I'll be updating it over the next few days. Feel free to add comments on the discussion page (this would be the spot to take on tasks for those with the tuits): http://www.bioperl.org/wiki/Talk:Release_Schedule chris Chris Fields 2008-11-17T14:13:02 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17894 All, I'm still working on an overall plan for a 1.6 release and fixing some bugs. In the meantime, for my sanity I'm planning on doing some test reorganization in subversion, starting with splitting up SearchIO.t (which has become very long and unwieldy) into separate format- specific test files. This may be something to think about for other sets of modules as well which are plugin-able or parser-specific (SeqIO, AlignIO, Bio::Tools*, etc). Though it will lead to quite a few more files, I think it will be easier in the long term to identify and fix format-specific bugs. It also may be helpful in the long term with splitting up bioperl into subdistributions, identifying holes in test coverage, deprecating unsupported modules, etc. The details (of course subject to debate!): 1) Tests which are parser-specific will be moved to test files in the form SearchIO_*.t, where the '*' represents the specific parser being tested. 2) Tests for methods implemented in SearchIO.pm (such as _ Chris Fields 2008-11-16T16:38:39 http://comments.gmane.org/gmane.comp.lang.perl.bio.general/17893 Hi, I’m using Perl to query DBBJ using SOAP. I want to find all genes of a given species in the database. However, the different SOAP services available like GetEntry only allow you to retrieve records by accession number. Do you know how I could find all genes of a species? Thank you very much. tomas_bar 2008-11-16T15:58:09 Search the mailing list at Gmane query http://search.gmane.org/?group=$group=gmane.comp.lang.perl.bio.general