gmane.comp.lang.perl.bio.general

About graphic rendering

Paolo Pavan — 2008-12-03T18:21:50

Hi everybody, I've a question about a Bio::Graphics rendering. I would like to display a blast HSP on a track but I would like to draw the "tails" of my mapping sequence that don't match the subject. So I instantiate these 3 object that represent all the three segments I want to display: my $feature = Bio::SeqFeature::Generic->new( -display_name =>$sequence_to_map->display_id, -start =>$hsp->sbjct->start, -end =>$hsp->sbjct->end, ); my $feature_pre = Bio::SeqFeature::Generic->new( -start =>($hsp->sbjct->start - $hsp->query->start), -end =>$hsp->sbjct->start-1 ); my $feature_post = Bio::SeqFeature::Generic->new( -start => $hsp->sbjct->end+1, -end => $hsp->sbjct->end + $sequence_to_map->length - $hsp->query->end ); now I have to add these features to my $track in a manner that the $feature_pre and $feature_post paint or color in a different way than $feature but align horizontally. I tried with: $feature->add_sub_SeqFeature($feature_pre, 'EXPAND'); $feature->add_sub_SeqFeature($feature_post, 'EXPAND'); $track->add_feature($feature); This does not work, because the features spread vertically, and more I cannot change the glyph because seems to be a track property, not a feature one. Any idea? Thank you for your help, Paolo

PullHSP bug

Chris Fields — 2008-12-02T23:03:21

Sendu, I found a silent bug while fixing some issues with SimpleAlign which are causing blast_pull tests to fail (HSP-related). It appears that the query sequence ID is not being caught, causing LocatableSeq::get_nse() to throw an exception within SimpleAlign when using PullHSPI::get_aln. It appears that the hit seq ID is caught properly, though (hence the oddness). All other SearchIO.t tests pass. Could you look into this? ... ok 165 ok 166 ok 167 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Attribute id not set STACK: Error::throw STACK: Bio::Root::Root::throw /Users/cjfields/bioperl/bioperl-live/ blib/lib/Bio/Root/Root.pm:357 STACK: Bio::LocatableSeq::get_nse /Users/cjfields/bioperl/bioperl-live/ blib/lib/Bio/LocatableSeq.pm:301 STACK: Bio::SimpleAlign::add_seq /Users/cjfields/bioperl/bioperl-live/ blib/lib/Bio/SimpleAlign.pm:293 STACK: Bio::Search::HSP::PullHSPI::get_aln /Users/cjfields/bioperl/ bioperl-live/blib/lib/Bio/Search/HSP/PullHSPI.pm:471 STACK: t/SearchIO/blast_pull.t:237 ----------------------------------------------------------- # Looks like you planned 287 tests but only ran 167. # Looks like your test died just after 167. Dubious, test returned 255 (wstat 65280, 0xff00) Failed 120/287 subtests Test Summary Report ------------------- t/SearchIO/blast_pull.t (Wstat: 65280 Tests: 167 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 287 tests but ran 167. Files=1, Tests=167, 1 wallclock secs ( 0.04 usr 0.01 sys + 0.34 cusr 0.04 csys = 0.43 CPU) Result: FAIL Failed 1/1 test programs. 0/167 subtests failed.

Fw: Help with installation

Assiatu Barrie — 2008-12-02T17:40:31

Assiatu Barrie Dept. of Biology Univ of TX, Arlington Arlington, TX 76019 abarrie< at >uta.edu assiatu_barrie< at >yahoo.com www.uta.edu --- On Tue, 12/2/08, Assiatu Barrie yahoo.com> wrote: From: Assiatu Barrie yahoo.com> Subject: Help with installation To: bioperl-l< at >biolperl.org Date: Tuesday, December 2, 2008, 11:36 AM Hello My name is Assiatu Barrie, a grad student from UTA. I am trying to download bioperl on my mac os laptop but unsuccessful, please help. I keep getting an error message regarding Make not been installed. I tried installing Build.pl, but not successful. I am very very new to perl so I will really appreciate the help. Thank you Assiatu Barrie Dept. of Biology Univ of TX, Arlington Arlington, TX 76019 abarrie< at >uta.edu assiatu_barrie< at >yahoo.com www.uta.edu

global verbosity

Mark A. Jensen — 2008-12-03T15:23:32

I was looking for a way to set verbosity globally (but not for debugging), so that all subsequently created objects would be absolutely quiet. I found $Bio::Root::Root:VERBOSITY, but saw that it didn't matter to downstream objects when it was changed. Digging in to the issue, found that global verbosity can't really be set, though one can access the value of $VERBOSITY with Bio::Root::Root::verbose(). http://bugzilla.open-bio.org/show_bug.cgi?id=2696 has a patch + .t to Root.pm that I think solves the issue, allowing getting and setting of global verbosity, so that the global value now propagates to new objects. There is a stickier issue (example using Bio::Seq and Bio::Seq->primary_seq() in the .t file), in which setting an object's verbosity post-construction does not propagate to sub-objects contained in the object, so that one might not get what one expects. cheers MAJ

Problem in OMIM parser

neeti somaiya — 2008-12-02T05:54:14

Hi, I am downloading the OMIM genemap file from here : ftp://ftp.ncbi.nih.gov/repository/OMIM/ I was using the OMIMparser all these days to parse the genemap and omim.txt files and get the relevant data, and it was working perfect, but today suddenly I got an exception at the following line of my code : my $omim_parser = Bio::Phenotype::OMIM::OMIMparser->new(-genemap => $genemap,-omimtext => $omimtext); The exception I got was : ------------- EXCEPTION ------------- MSG: Gene map file "genemap" is not in the expected format STACK Bio::Phenotype::OMIM::OMIMparser::_read_genemap /root/BiologicalDatabases/OMIM/OMIMparser.pm:881 STACK Bio::Phenotype::OMIM::OMIMparser::genemap_file_name /root/BiologicalDatabases/OMIM/OMIMparser.pm:408 STACK Bio::Phenotype::OMIM::OMIMparser::new /root/BiologicalDatabases/OMIM/OMIMparser.pm:224 STACK main::main parseOmimData.pl:56 STACK toplevel parseOmimData.pl:39 -------------------------------------- Please suggest what I can do now.

reorgansing tests by group

Heikki Lehvaslaiho — 2008-12-02T04:45:47

I just had a go at reorganising some tests by group in bioperl-live. Seems to work like charm. The work flow is: 1. mkdir group 2. svn move test.t. group More instructions are in: http://www.bioperl.org/wiki/Talk:Release_1.6#Test_suite The more I think about this the better I like it. By reorganising tests, we can see what kind of groups were have in Bio name space. Moving tests around is cheap and easy and does not affect code at all. We can experiment to our harts content. Unless I have done some big boo-boo and someone yells at me, I am going to go on reorganising test (when I've got time later this week). -Heikki

problem with bp_genbank2gff3.pl

ANJAN PURKAYASTHA — 2008-12-01T22:05:16

hi, i copied and pasted the genbank2gff3.pls script into a file /usr/bin/bp_genbank2gff3.pl and tried running it. error message: Can't locate object method "FT_SO_map" via package "Bio::SeqFeature::Tools::TypeMapper" at /usr/bin/bp_genbank2gff3.pl line 285. any idea how i get to the map FT_SO_map method? thanks, anjan

on FootPrinter

Munirul Islam — 2008-12-01T23:44:24

Hi: We are trying to install FootPrinter on a linux machine. But we are getting errors. We also tried on MAC. Anyone here successfully installed it? I saw bioperl supports FootPrinter. http://search.cpan.org/~birney/bioperl-run-1.4/Bio/Tools/Run/FootPrinter.pm Your installation experience would definitely help us. Thank you. Munir Computer Science Wayne State University

verbose turned on by PrimarySeq->new()

Dave Messina — 2008-11-28T12:11:13

Hey everyone, In trying to figure out why the SeqIO::largefasta tests were being verbose about tempfile cleanup, I discovered that the PrimarySeq constructor turns on verbose, which gets inherited by LargePrimarySeq, which in turn cause RootIO to overshare about the temp files. (see PrimarySeq.pm line 164). The verbose flag was put in when Mira Han added -nowarnonempty. Turning verbose off doesn't seem to cause any tests to fail, so it looks like it might have been turned on for initial debugging purposes and never removed. Mira (or anyone else in the know), could you comment on this? Dave

general coordinate transformation in LocatableSeq

Mark A. Jensen — 2008-11-28T02:20:30

Chris and others interested- Under bug #2689 I've taken a stab add moving in and out of sequence coordinate systems in a general way (aa to/from nt, but also say repeats to/from mnemonics), under the guise of a subseq() method for LocatableSeq. Prob not for this release, but may be helpful for other components as things become (even) more generalized in future. This subseq also handles frameshifts. Would be grateful for comments (after the rush)- cheers MAJ

How to write a Bio::DB:Fasta sequence into a file?

Peng Yu — 2008-11-27T03:03:54

Hi, It shows in the tutorial, that I can use the following command to write a gene into a file. $seq_object = get_sequence('swiss',"ROA1_HUMAN"); write_sequence(">roa1.fasta",'fasta',$seq_object); I'm wondering how to write a gene (id is available) of Bio::DB:Fasta into a file. Thanks, Peng

Bioperl 1.6 and Bio::Graphics

Chris Fields — 2008-11-26T17:29:58

Lincoln, Scott, (and anyone else interested), One of the items on the list for the next bioperl release is whether to split off Bio::Graphics before 1.6 roles out: http://www.bioperl.org/wiki/ Talk:Release_1.6#Bio::Graphics_and_Splitting_BioPerl My general reasoning is that the Gbrowse devs can start releasing to CPAN on their own (bio-graphics specific) schedule and not be tied to the core release schedule. bio-graphics would just be tied in to a minimally compatible CPAN bioperl-core release. The link above elaborates more on the idea as well as potential issues (versioning, etc). We don't have to do it for this release, but my concern is if it doesn't happen prior to 1.6 it will have to wait until 1.7 (date unknown), thus further impeding a Gbrowse 2.0. Therefore I think it's worth delaying 1.6 a couple weeks to see how this goes. Any comments over the next week or two would be appreciated (gotta factor in the holiday break!). chris (I've set the reply-to for the bioperl list, so hopefully we won't get double posting to both lists for responses)

MailMan delay

Jay Hannah — 2008-11-26T14:28:47

Hmm... It's been 1 hour, 23 minutes and counting since I sent my last post and I haven't received my copy yet, nor is it in the MailMan archive. What is the typical MailMan lag for this server nowadays? j IRC rules! Email drools! -grin- http://www.bioperl.org/wiki/Irc

BioPerl Installation on Suse 11.0 Failed ?

Imtiaz M. — 2008-11-26T13:52:39

I am trying to install bioperl 1.4 both from CPAN and from local directory after downloading but i am unable to get it running. here is some log of installation work. Please give me some suggestions how to proceed perl Makefile.PL Generated sub tests. go make show_tests to see available subtests *** Script Install Section **** Bioperl comes with a number of useful scripts which you may wish to install. Install [a]ll Bioperl scripts, [n]one, or choose groups [i]nteractively? [a] cannot unlink file for scripts_temp/bp_pg_bulk_load_gff.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_pg_bulk_load_gff.pl: P ermission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_process_gadfly.pl: Permission denied at M akefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_process_gadfly.pl: Per mission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_composite_LD.pl: Permission denied at Mak efile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_composite_LD.pl: Permi ssion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_index.pl: Permission denied at Makefile.P L line 118 cannot restore permissions to 0100555 for scripts_temp/bp_index.pl: Permission d enied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_dbsplit.pl: Permission denied at Makefile .PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_dbsplit.pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_filter_search.pl: Permission denied at Ma kefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_filter_search.pl: Perm ission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_bioflat_index.pl: Permission denied at Ma kefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_bioflat_index.pl: Perm ission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_pairwise_kaks.pl: Permission denied at Ma kefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_pairwise_kaks.pl: Perm ission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_mutate.pl: Permission denied at Makefile. PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_mutate.pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_taxid4species.pl: Permission denied at Ma kefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_taxid4species.pl: Perm ission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_nrdb.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_nrdb.pl: Permission de nied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_heterogeneity_test.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_heterogeneity_test.pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_chaos_plot.pl: Permission denied at Makef ile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_chaos_plot.pl: Permiss ion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_oligo_count.pl: Permission denied at Make file.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_oligo_count.pl: Permis sion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_blast2tree.pl: Permission denied at Makef ile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_blast2tree.pl: Permiss ion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_biofetch_genbank_proxy.pl: Permission den ied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_biofetch_genbank_proxy .pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_search2alnblocks.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_search2alnblocks.pl: P ermission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_search2tribe.pl: Permission denied at Mak efile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_search2tribe.pl: Permi ssion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_seqconvert.pl: Permission denied at Makef ile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_seqconvert.pl: Permiss ion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_mask_by_search.pl: Permission denied at M akefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_mask_by_search.pl: Per mission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_sreformat.pl: Permission denied at Makefi le.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_sreformat.pl: Permissi on denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_seq_length.pl: Permission denied at Makef ile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_seq_length.pl: Permiss ion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_extract_feature_seq.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_extract_feature_seq.pl : Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_split_seq.pl: Permission denied at Makefi le.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_split_seq.pl: Permissi on denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_mrtrans.pl: Permission denied at Makefile .PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_mrtrans.pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_aacomp.pl: Permission denied at Makefile. PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_aacomp.pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_remote_blast.pl: Permission denied at Mak efile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_remote_blast.pl: Permi ssion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_flanks.pl: Permission denied at Makefile. PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_flanks.pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_genbank2gff.pl: Permission denied at Make file.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_genbank2gff.pl: Permis sion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_process_sgd.pl: Permission denied at Make file.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_process_sgd.pl: Permis sion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_process_wormbase.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_process_wormbase.pl: P ermission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_gccalc.pl: Permission denied at Makefile. PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_gccalc.pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_generate_histogram.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_generate_histogram.pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_fast_load_gff.pl: Permission denied at Ma kefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_fast_load_gff.pl: Perm ission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_local_taxonomydb_query.pl: Permission den ied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_local_taxonomydb_query .pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_process_ncbi_human.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_process_ncbi_human.pl: Permission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_load_gff.pl: Permission denied at Makefil e.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_load_gff.pl: Permissio n denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_biogetseq.pl: Permission denied at Makefi le.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_biogetseq.pl: Permissi on denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_feature_draw.pl: Permission denied at Mak efile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_feature_draw.pl: Permi ssion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_search2gff.pl: Permission denied at Makef ile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_search2gff.pl: Permiss ion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_search_overview.pl: Permission denied at Makefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_search_overview.pl: Pe rmission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_bulk_load_gff.pl: Permission denied at Ma kefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_bulk_load_gff.pl: Perm ission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_frend.pl: Permission denied at Makefile.P L line 118 cannot restore permissions to 0100555 for scripts_temp/bp_frend.pl: Permission d enied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_translate_seq.pl: Permission denied at Ma kefile.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_translate_seq.pl: Perm ission denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_fetch.pl: Permission denied at Makefile.P L line 118 cannot restore permissions to 0100555 for scripts_temp/bp_fetch.pl: Permission d enied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_search2BSML.pl: Permission denied at Make file.PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_search2BSML.pl: Permis sion denied at Makefile.PL line 118 cannot unlink file for scripts_temp/bp_biblio.pl: Permission denied at Makefile. PL line 118 cannot restore permissions to 0100555 for scripts_temp/bp_biblio.pl: Permission denied at Makefile.PL line 118 cannot remove directory for ./scripts_temp: Directory not empty at Makefile.PL l ine 118 cannot restore permissions to 0755 for ./scripts_temp: Operation not permitted a t Makefile.PL line 118 External Module GD::SVG, Generate optional SVG output, is not installed on this computer. The in Bioperl needs it for Bio::Graphics External Module Ace, Aceperl, is not installed on this computer. The Bio::DB::Ace in Bioperl needs it for access of ACeDB database External Module SOAP::Lite, SOAP protocol, is not installed on this computer. The Bio::DB::XEMBLService in Bioperl needs it for XEMBL Services (also Bibliog raphic queries in Biblio::) External Module GD, Graphical Drawing Toolkit, is not installed on this computer. The Bio::Graphics in Bioperl needs it for Rendering Sequences and Features External Module XML::Twig, Available on CPAN, is not installed on this computer. The Module Bio::Variation::IO::xml.pm in Bioperl needs it for parsing of XML d ocuments External Module SVG, Generate optional SVG output, is not installed on this computer. The in Bioperl needs it for Bio::Graphics External Module Text::Shellwords, Execute shell commands, is not installed on this computer. The Bio::Graphics in Bioperl needs it for test scripts External Module XML::Parser::PerlSAX, Parsing of XML documents, is not installed on this computer. The Bio::SeqIO::game,Bio::Variation::* in Bioperl needs it for Bio::Variation code, GAME parser External Module DBD::mysql, Mysql driver, is not installed on this computer. The Bio::DB::GFF in Bioperl needs it for loading and querying of Mysql-based G FF feature databases External Module Graph::Directed, Generic Graph data stucture and algorithms, is not installed on this computer. The Bio::Ontology::SimpleOntologyEngine in Bioperl needs it for Ontology Engin e implementation for the GO parser Information: There are some external packages and perl modules, listed above, which bioperl uses. This only effects the functionality which is listed above: the rest of bioperl will work fine, which includes nearly all of the core packages. The installation of these external packages is very simple. You can read more about bioperl external dependencies in the INSTALL file or at: http://bioperl.org/Core/Latest/INSTALL Enjoy the rest of bioperl, which you can use after going 'make install' Writing Makefile for Bio shafiq< at >linux-22nr:~/source/bio> make shafiq< at >linux-22nr:~/source/bio> make test PERL_DL_NONLAZY=1 /usr/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t t/AAChange...................ok t/AAReverseMutate............ok t/AlignIO....................ok t/AlignStats.................ok t/Allele.....................ok t/Alphabet...................ok t/Annotation.................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/Annotation.................ok t/AnnotationAdaptor..........ok t/Assembly...................ok t/Biblio.....................SOAP::Lite not installed. Skipping some tests. t/Biblio.....................ok 1/24 skipped: various reasons t/Biblio_biofetch............ok t/BiblioReferences...........ok t/BioDBGFF...................ok t/BioFetch_DB................FAILED tests 8, 20-21, 27 Failed 4/27 tests, 85.19% okay t/BioGraphics................GD or Text::Shellwords modules are not installed. T his means that Bio::Graphics module is unusable. Skipping tests. t/BioGraphics................ok t/BlastIndex.................ok t/BPbl2seq...................ok t/BPlite.....................ok t/BPpsilite..................ok t/Chain......................ok t/cigarstring................ok t/ClusterIO..................XML::Parser::PerlSAX not loaded. This means Cluster IO::dbsnp test cannot be executed. Skipping t/ClusterIO..................ok t/Coalescent.................ok t/CodonTable.................ok t/consed.....................ok t/CoordinateGraph............ok t/CoordinateMapper...........ok t/Correlate..................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/Correlate..................ok t/CytoMap....................ok t/DB.........................FAILED tests 30-31 Failed 2/78 tests, 97.44% okay (less 1 skipped test: 75 okay, 96.15%) t/DBCUTG.....................ok t/DBFasta....................ok t/DNAMutation................ok t/Domcut.....................ok t/ECnumber...................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/ECnumber...................ok t/ELM........................ok 1/14 -------------------- WARNING --------------------- MSG: Bio::Tools::Analysis::Protein::ELM Request Error: 400 URL must be absolute Content-Type: text/plain Client-Date: Wed, 26 Nov 2008 13:50:44 GMT Client-Warning: Internal response 400 URL must be absolute --------------------------------------------------- t/ELM........................ok t/EMBL_DB....................FAILED tests 6, 13-14 Failed 3/15 tests, 80.00% okay t/EMBOSS_Tools...............ok t/EncodedSeq.................ok t/ePCR.......................ok t/ESEfinder..................ok t/est2genome.................ok t/Exception..................ok t/Exonerate..................ok t/flat.......................ok t/FootPrinter................ok t/game.......................XML::Parser::PerlSAX not loaded. This means game te st cannot be executed. Skipping t/game.......................ok t/GDB........................ok t/GeneCoordinateMapper.......ok 1/113 -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- t/GeneCoordinateMapper.......ok 83/113Use of uninitialized value in concatenatio n (.) or string at /home/shafiq/source/bio/blib/lib/Bio/Coordinate/GeneMapper.pm line 814. t/GeneCoordinateMapper.......ok t/Geneid.....................ok t/Genewise...................ok 2/51 skipped: various reasons t/Genomewise.................ok t/Genpred....................ok t/GFF........................ok 1/32Filehandle GEN0 opened only for output at /h ome/shafiq/source/bio/blib/lib/Bio/Root/IO.pm line 440. Filehandle GEN1 opened only for output at /home/shafiq/source/bio/blib/lib/Bio/R oot/IO.pm line 440. t/GFF........................ok t/GOR4.......................ok t/GOterm.....................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/GOterm.....................ok t/GuessSeqFormat.............ok 1/46Bio::SeqIO: game cannot be found Exception ------------- EXCEPTION ------------- MSG: Failed to load module Bio::SeqIO::game. Can't locate XML/Parser/PerlSAX.pm in < at >INC (< at >INC contains: t .. /home/shafiq/source/bio/blib/lib /home/shafiq/sourc e/bio/blib/arch /usr/lib/perl5/5.10.0/i586-linux-thread-multi /usr/lib/perl5/5.1 0.0 /usr/lib/perl5/site_perl/5.10.0/i586-linux-thread-multi /usr/lib/perl5/site_ perl/5.10.0 /usr/lib/perl5/vendor_perl/5.10.0/i586-linux-thread-multi /usr/lib/p erl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl .) at /home/shafiq/source/bio /blib/lib/Bio/SeqIO/game/gameSubs.pm line 70. BEGIN failed--compilation aborted at /home/shafiq/source/bio/blib/lib/Bio/SeqIO/ game/gameSubs.pm line 70. Compilation failed in require at /home/shafiq/source/bio/blib/lib/Bio/SeqIO/game /gameHandler.pm line 62. BEGIN failed--compilation aborted at /home/shafiq/source/bio/blib/lib/Bio/SeqIO/ game/gameHandler.pm line 62. Compilation failed in require at /home/shafiq/source/bio/blib/lib/Bio/SeqIO/game .pm line 76. BEGIN failed--compilation aborted at /home/shafiq/source/bio/blib/lib/Bio/SeqIO/ game.pm line 76. Compilation failed in require at /home/shafiq/source/bio/blib/lib/Bio/Root/Root. pm line 394. STACK Bio::Root::Root::_load_module /home/shafiq/source/bio/blib/lib/Bio/Root/Ro ot.pm:396 STACK (eval) /home/shafiq/source/bio/blib/lib/Bio/SeqIO.pm:549 STACK Bio::SeqIO::_load_format_module /home/shafiq/source/bio/blib/lib/Bio/SeqIO .pm:548 STACK Bio::SeqIO::new /home/shafiq/source/bio/blib/lib/Bio/SeqIO.pm:377 STACK (eval) t/GuessSeqFormat.t:61 STACK toplevel t/GuessSeqFormat.t:60 -------------------------------------- For more information about the SeqIO system please see the SeqIO docs. This includes ways of checking for formats at compile time, not run time t/GuessSeqFormat.............FAILED test 11 Failed 1/46 tests, 97.83% okay t/hmmer......................ok t/HNN........................ok t/Index......................ok t/InstanceSite...............ok t/InterProParser.............ok 1/47Bio::OntologyIO: InterProParser cannot be fo und Exception ------------- EXCEPTION ------------- MSG: Failed to load module Bio::OntologyIO::InterProParser. Can't locate XML/Par ser/PerlSAX.pm in < at >INC (< at >INC contains: t .. . ./blib/lib /home/shafiq/source/bio /blib/lib /home/shafiq/source/bio/blib/arch /usr/lib/perl5/5.10.0/i586-linux-thr ead-multi /usr/lib/perl5/5.10.0 /usr/lib/perl5/site_perl/5.10.0/i586-linux-threa d-multi /usr/lib/perl5/site_perl/5.10.0 /usr/lib/perl5/vendor_perl/5.10.0/i586-l inux-thread-multi /usr/lib/perl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl) at Bio/OntologyIO/InterProParser.pm line 84. BEGIN failed--compilation aborted at Bio/OntologyIO/InterProParser.pm line 84. Compilation failed in require at Bio/Root/Root.pm line 394. STACK Bio::Root::Root::_load_module Bio/Root/Root.pm:396 STACK (eval) Bio/OntologyIO.pm:255 STACK Bio::OntologyIO::_load_format_module Bio/OntologyIO.pm:254 STACK Bio::OntologyIO::new Bio/OntologyIO.pm:165 STACK toplevel t/InterProParser.t:52 -------------------------------------- For more information about the OntologyIO system please see the docs. This includes ways of checking for formats at compile time, not run time t/InterProParser.............NOK 2/47Can't call method "next_ontology" on an und efined value at t/InterProParser.t line 59. t/InterProParser.............dubious Test returned status 2 (wstat 512, 0x200) DIED. FAILED test 2 Failed 1/47 tests, 97.87% okay t/IUPAC......................ok t/largefasta.................ok t/largepseq..................ok t/LinkageMap.................ok t/LiveSeq....................ok t/LocatableSeq...............ok t/Location...................ok t/LocationFactory............ok t/LocusLink..................ok 1/23Useless localization of scalar assignment at /home/shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/LocusLink..................ok t/lucy.......................ok t/Map........................ok t/MapIO......................ok t/Matrix.....................ok t/Measure....................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/Measure....................ok t/MeSH.......................ok t/MetaSeq....................ok t/MicrosatelliteMarker.......ok t/MiniMIMentry...............Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/MiniMIMentry...............ok t/MitoProt...................ok t/Molphy.....................ok t/multiple_fasta.............ok t/Mutation...................ok t/Mutator....................ok t/NetPhos....................ok t/Node.......................ok t/OddCodes...................ok t/OMIMentry..................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/OMIMentry..................ok t/OMIMentryAllelicVariant....Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/OMIMentryAllelicVariant....ok t/OMIMparser.................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/OMIMparser.................ok t/Ontology................... Graph.pm doesn't seem to be installed on this system -- the GO Parser needs it.. . t/Ontology...................ok t/OntologyEngine.............Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/OntologyEngine.............ok t/PAML.......................ok t/Perl.......................ok 1/14Use of uninitialized value $au in substituti on (s///) at /home/shafiq/source/bio/blib/lib/Bio/SeqIO/swiss.pm line 855, line 45. t/Perl.......................ok t/phd........................ok t/Phenotype..................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/Phenotype..................ok t/PhylipDist.................ok t/pICalculator...............ok t/Pictogram..................SVG not installed, skipping tests at t/Pictogram.t line 29. t/Pictogram..................ok t/PopGen.....................ok t/PopGenSims.................ok t/primaryqual................ok t/PrimarySeq.................ok t/primedseq..................ok t/Primer.....................ok t/primer3....................ok t/Promoterwise...............ok t/ProtDist...................ok t/psm........................ok t/QRNA.......................ok t/qual.......................ok t/RandDistFunctions..........ok t/RandomTreeFactory..........ok t/Range......................ok t/RangeI.....................ok t/RefSeq.....................ok t/Registry...................DB_File and BerkeleyDB not found. Skipping DB_File tests t/Registry...................ok t/Relationship...............Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/Relationship...............ok t/RelationshipType...........Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/RelationshipType...........ok t/RemoteBlast................ok 4/6 skipped: various reasons t/RepeatMasker...............ok t/RestrictionAnalysis........ok t/RestrictionEnzyme..........ok t/RestrictionIO..............ok 1/14 ------------- EXCEPTION ------------- MSG: Could not open >/tmp/r: Permission denied STACK Bio::Root::IO::_initialize_io /home/shafiq/source/bio/blib/lib/Bio/Root/IO .pm:273 STACK Bio::SeqIO::_initialize /home/shafiq/source/bio/blib/lib/Bio/SeqIO.pm:447 STACK Bio::Restriction::IO::base::_initialize /home/shafiq/source/bio/blib/lib/B io/Restriction/IO/base.pm:87 STACK Bio::Restriction::IO::base::new /home/shafiq/source/bio/blib/lib/Bio/Restr iction/IO/base.pm:81 STACK Bio::Restriction::IO::new /home/shafiq/source/bio/blib/lib/Bio/Restriction /IO.pm:152 STACK toplevel t/RestrictionIO.t:49 -------------------------------------- t/RestrictionIO..............dubious Test returned status 13 (wstat 3328, 0xd00) DIED. FAILED tests 7-14 Failed 8/14 tests, 42.86% okay t/RNAChange..................ok t/RootI......................ok t/RootIO.....................ok t/RootStorable...............ok t/Scansite...................ok t/scf........................ok t/SearchDist.................ok t/SearchIO...................XML::Parser::PerlSAX or HTML::Entities not loaded. This means SearchIO::blastxml test cannot be executed. Skipping t/SearchIO...................ok t/Seq........................ok t/SeqAnalysisParser..........ok t/SeqBuilder.................ok t/SeqDiff....................ok t/SeqFeatCollection..........ok t/SeqFeature.................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/SeqFeature.................ok t/seqfeaturePrimer...........ok t/SeqIO......................ok 3/235 skipped: various reasons t/SeqPattern.................ok t/SeqStats...................ok t/SequenceFamily.............ok t/sequencetrace..............ok t/SeqUtils...................ok t/seqwithquality.............ok t/SeqWords...................ok t/Sigcleave..................ok t/Sim4.......................ok t/SimilarityPair.............ok t/SimpleAlign................ok t/simpleGOparser............. Graph.pm doesn't seem to be installed on this system -- the GO Parser needs it.. . t/simpleGOparser.............ok t/sirna......................ok t/SiteMatrix.................ok t/SNP........................ok t/Sopma......................ok t/Species....................ok t/splicedseq.................ok t/StandAloneBlast............ok t/StructIO...................ok t/Structure..................ok t/Swiss......................ok 1/5 ------------- EXCEPTION ------------- MSG: Could not open >test.swiss: Permission denied STACK Bio::Root::IO::_initialize_io /home/shafiq/source/bio/blib/lib/Bio/Root/IO .pm:273 STACK Bio::SeqIO::_initialize /home/shafiq/source/bio/blib/lib/Bio/SeqIO.pm:447 STACK Bio::SeqIO::swiss::_initialize /home/shafiq/source/bio/blib/lib/Bio/SeqIO/ swiss.pm:131 STACK Bio::SeqIO::new /home/shafiq/source/bio/blib/lib/Bio/SeqIO.pm:358 STACK Bio::SeqIO::new /home/shafiq/source/bio/blib/lib/Bio/SeqIO.pm:378 STACK toplevel t/Swiss.t:49 -------------------------------------- t/Swiss......................dubious Test returned status 13 (wstat 3328, 0xd00) DIED. FAILED tests 3-5 Failed 3/5 tests, 40.00% okay t/Symbol.....................ok t/Taxonomy...................ok t/Tempfile...................ok t/Term.......................Useless localization of scalar assignment at /home/ shafiq/source/bio/blib/lib/Bio/Root/Object.pm line 699. t/Term.......................ok t/Tools......................ok t/Tree.......................ok t/TreeIO.....................ok t/trim.......................ok t/tutorial...................ok 3/21Use of uninitialized value $au in substituti on (s///) at Bio/SeqIO/swiss.pm line 855, line 45. t/tutorial...................ok 17/21Bio::SeqIO: game cannot be found Exception ------------- EXCEPTION ------------- MSG: Failed to load module Bio::SeqIO::game. Can't locate XML/Parser/PerlSAX.pm in < at >INC (< at >INC contains: . t /home/shafiq/source/bio/blib/lib /home/shafiq/source /bio/blib/arch /usr/lib/perl5/5.10.0/i586-linux-thread-multi /usr/lib/perl5/5.10 .0 /usr/lib/perl5/site_perl/5.10.0/i586-linux-thread-multi /usr/lib/perl5/site_p erl/5.10.0 /usr/lib/perl5/vendor_perl/5.10.0/i586-linux-thread-multi /usr/lib/pe rl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl) at Bio/SeqIO/game/gameSubs.pm line 70. BEGIN failed--compilation aborted at Bio/SeqIO/game/gameSubs.pm line 70. Compilation failed in require at Bio/SeqIO/game/gameHandler.pm line 62. BEGIN failed--compilation aborted at Bio/SeqIO/game/gameHandler.pm line 62. Compilation failed in require at Bio/SeqIO/game.pm line 76. BEGIN failed--compilation aborted at Bio/SeqIO/game.pm line 76. Compilation failed in require at /home/shafiq/source/bio/blib/lib/Bio/Root/Root. pm line 394. STACK Bio::Root::Root::_load_module /home/shafiq/source/bio/blib/lib/Bio/Root/Ro ot.pm:396 STACK (eval) /home/shafiq/source/bio/blib/lib/Bio/SeqIO.pm:549 STACK Bio::SeqIO::_load_format_module /home/shafiq/source/bio/blib/lib/Bio/SeqIO .pm:548 STACK Bio::SeqIO::new /home/shafiq/source/bio/blib/lib/Bio/SeqIO.pm:377 STACK (eval) /home/shafiq/source/bio/blib/lib/bptutorial.pl:4027 STACK main::__ANON__ /home/shafiq/source/bio/blib/lib/bptutorial.pl:4025 STACK main::run_examples /home/shafiq/source/bio/blib/lib/bptutorial.pl:4152 STACK toplevel t/tutorial.t:23 -------------------------------------- For more information about the SeqIO system please see the SeqIO docs. This includes ways of checking for formats at compile time, not run time Can't call method "next_seq" on an undefined value at /home/shafiq/source/bio/bl ib/lib/bptutorial.pl line 4035. t/tutorial...................dubious Test returned status 2 (wstat 512, 0x200) DIED. FAILED tests 19-21 Failed 3/21 tests, 85.71% okay t/UCSCParsers................ok t/Unflattener................ok t/Unflattener2...............ok t/UniGene....................ok t/Variation_IO...............ok 3/25 The XML-format conversion requires the CPAN modules XML::Twig, XML::Writer, and IO::String to be installed on your system, which they probably aren't. Skipping these tests. t/Variation_IO...............ok t/WABA.......................ok t/XEMBL_DB...................SOAP::Lite and/or XML::DOM not installed. This mean s that Bio::DB::XEMBL module is not usable. Skipping tests. t/XEMBL_DB...................ok Failed Test Stat Wstat Total Fail List of Failed ------------------------------------------------------------------------------- t/BioFetch_DB.t 27 4 8 20-21 27 t/DB.t 78 2 30-31 t/EMBL_DB.t 15 3 6 13-14 t/GuessSeqFormat.t 46 1 11 t/InterProParser.t 2 512 47 1 2 t/RestrictionIO.t 13 3328 14 16 7-14 t/Swiss.t 13 3328 5 6 3-5 t/tutorial.t 2 512 21 6 19-21 11 subtests skipped. Failed 8/179 test scripts. 25/8122 subtests failed. Files=179, Tests=8122, 119 wallclock secs (67.10 cusr + 3.36 csys = 70.46 CPU) Failed 8/179 test programs. 25/8122 subtests failed. make: *** [test_dynamic] Error 255

writing bioperl modules

Tim — 2008-11-26T11:30:18

Hi, I'm just curious to know if bioperl is considered complete or are there still projects that programmers can become involved in. I notice that for other bio-languages there are on-going hackathons were programmers can meet and work on a problem. Do these exist in bio-perl or is the code base now mature? thanks, tim

unable to open swissprot.nin

bioperl_inquisitive — 2008-11-24T17:54:28

hey ppl ... I'm having a problem at the last step of blast installation on windows.:-( blastall -p blastn -d swissprot -i fasta_query.txt -o output.txt Its showing an Error like this: [NULL_Caption] WARNING: Unable to open swissprot.nin [NULL_Caption] WARNING: gi 157836126 pdb 2QOX Z: Unable to open swissprot.nin Any help will be appreciated !! Thanks in advance.

Update of bioperl-ext for modern environment

Thomas Jahns — 2008-11-20T13:04:51

Hello everyone, I hope I didn't duplicate anyone's work, but I couldn't find anything on this in the archives and so I patched bioperl-ext-1.5.1 to work with - bioperl-1.5.2_102 - staden io_lib 1.11.4 and not crash perl. Please see attached patch, I hope someone reading here can integrate it with the repository. There is one necessary externally visible change: instead of specifiyng /foo/include/io_lib for the headers of the staden package, one now needs to specify /foo/include, because read.h includes other files with io_lib prefix. I hope I removed the double-free bug in the right place, if the free'ing of a pointer passed into the function pgreen was intentional, another strategy will be needed. Also I found make clean to be dysfunctional, but I don't know enough about MakeMaker to fix that, thus for recompiles I used a script for cleanup (also attached). Greetings, Thomas Jahns

quick pairwise alignment

Alper Yilmaz — 2008-11-25T18:15:56

Hi, I am getting two nucleotide sequences from a database and I want to quickly align and view the result online(I'll wrap it in HTML). The examples I saw online require saving files (either output file or input file). I tried StandAloneBlast and tried to pass the sequences as Bio::Seq elements as shown below First I tried the Bioperl tutorial, section "IV.2.2 Aligning 2 sequences with Blast using bl2seq and AlignIO" $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out'); my $seq1='AGCTACGATCAGCACTACGACTACGACTACGACTACACTAGCTAC' ; my $seq2='AGCTACGATCACCACTACGACTACGGCTACGACTACACGAGCTAC' ; $bl2seq_report = $factory->bl2seq($seq1, $seq2); The result I got was the following error: ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: AGCTACGATCAGCACTACGACTACGACTACGACTACACTAGCTAC not Seq Object or file name! Then I used Bio::Seq objects as shown: my $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => '/tmp/bl2seq.out'); my $seq1 = Bio::Seq->new(-id=>$seqname1,-seq=>$ntseq1); my $seq2 = Bio::Seq->new(-id=>$seqname2,-seq=>$ntseq2); my $alignment = $factory->bl2seq($seq1, $seq2); - The result I got is bl2seq crashed error. As fas as I can tell StandAloneBlast cannot write to temporary files that are defined by "_rootio_tempfiles" in Bio::Root::IO. The detail is below: ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: bl2seq call crashed: 256 | No such file or directory | /usr/bin/bl2seq -j /tmp/sNpLUbS6jJ -i /tmp/aNWLAj_ZDN -o /tmp/bl2seq.out So, is there a way to do alignments without reading/writing files? Is there a quick way to align two sequence that are kept in $seq1 and $seq2 variables? I had trouble installing Bioperl-Ext package, if there's a tool in that package I can try harder to install Ext package. thanks, alper

bioperl.lisp bugs

Chris Fields — 2008-11-25T17:51:49

I'm not a user of this file, so if any users of the bioperl.lisp file in svn can comment on the following two bugs it would be of tremendous help. I'm sure they're fine but I would like to know if they should be accepted for the next release. http://bugzilla.open-bio.org/show_bug.cgi?id=2641 http://bugzilla.open-bio.org/show_bug.cgi?id=2642 chris

Bio::Assembly tests failing

Chris Fields — 2008-11-25T17:31:27

I am getting tests failing on svn trunk (bioperl-live) that appear related to Bio::Assembly changes. Florent, can you take a look at these? chris 1..4 ok 1 - use Bio::Assembly::IO; ok 2 - Testing to see if the first contig is a Contig isa Bio::Assembly::Contig not ok 3 - Testing to see if the first singlet is a Singlet isa Bio::Assembly::Singlet not ok 4 - Testing to see if the Singlet ISA Contig isa Bio::Assembly::Contig # Failed test 'Testing to see if the first singlet is a Singlet isa Bio::Assembly::Singlet' # at t/singlet.t line 25. # Testing to see if the first singlet is a Singlet isn't defined # Failed test 'Testing to see if the Singlet ISA Contig isa Bio::Assembly::Contig' # at t/singlet.t line 27. # Testing to see if the Singlet ISA Contig isn't defined # Looks like you failed 2 tests of 4. Dubious, test returned 2 (wstat 512, 0x200) Failed 2/4 subtests Test Summary Report ------------------- t/singlet.t (Wstat: 512 Tests: 4 Failed: 2) Failed tests: 3-4 Non-zero exit status: 2 Files=1, Tests=4, 1 wallclock secs ( 0.01 usr 0.01 sys + 0.26 cusr 0.04 csys = 0.32 CPU) Result: FAIL Failed 1/1 test programs. 2/4 subtests failed.

LocatableSeq::subseq(): bug or not?

Chris Fields — 2008-11-24T00:31:17

Currently, we have Bio::LocatableSeq use the default (Bio::PrimarySeq) implementation of subseq(). However the returned data apparently clashes with the actual PrimarySeq documentation: Function: returns the subseq from start to end, where the first base is 1 and the number is inclusive, ie 1-2 are the first two bases of the sequence So, should the following actually return the indicated range of bases (no gaps)? Or should we clarify the above documentation to indicate subseq() returns the first x positions/columns (anything) instead of 'bases' (no gaps)? my $seq = Bio::LocatableSeq->new( -seq => '--atg---gta--', -strand => 1, -start => 1, -end => 6, -alphabet => 'dna' ); # comments indicate current returned val $seq->subseq(1,3); # returns '--a' $seq->subseq(3,6); # returns 'atg-' $seq->subseq(1,10); # returns '--atg---gt' chris